Category: Social studies

Is it OK to leave fly masks on horses at night? Generally, a horse doesn’t need to wear a fly mask at night. If your horse has an eye condition and has been advised by a vet to wear a fly mask overnight, Field Relief fly masks can be left on 24/7. Note, whilst fly […]

How far is Fairbanks from Denver? 3101 miles How long is a flight from Colorado to Alaska? 5 hours, 31 minutes How long is a flight from China to Denver? Flying time from Denver, CO to Beijing, China The total flight duration from Denver, CO to Beijing, China is 13 hours, 13 minutes. How long […]

How long after eating beets is stool red? This usually lasts 48 hours, but it can vary in people who have a slow or faster rate of passing feces. It also depends on amount of fluids one drinks. Can beet juice turn your poop red? Can Beets Make Your Pee (And Poop) Red or Pink? […]

What is the career path for an EMT? Emergency medical technician jobs have a built in career ladder at least at the early career stages. When you complete your first training, you’re classified as an EMT-Basic. You can be classified as an EMT-Intermediate after working as an EMT-Basic and completing additional training and licensing requirements. […]

What is the voltage on 3 phase? 208 volts Can you have 230V 3 phase? Even at three phase you can use the 230V. You’ll have 3 times the power available. That’s called a star configuration. In delta you’ll have 3 × 400V, that’s 5.2 × the power at the same current. Is 3 phase […]

Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]

How much does it cost to bale hay? Swathing, $20-$22 per acre; Raking, $8-$10 per acre; Baling: small bales, 60-75 cents per bale; midsize (3×3), $10-$12 per bale; midsize (3×4), $14-$18 per bale; large square (4×4), $22-$25 per bale; round bales, $12-$15 per bale. How much does it cost to bale a round bale of […]

Are museums open in Idaho? We Are Open! The Idaho State Historical Society has updated its COVID-19 protocols under Stage 4 following Governor Little’s announcement on May 11, 2021. The Idaho State Museum requires face coverings be worn by visitors and staff indoors to help prevent the spread of COVID-19. Are museums open in Boise […]

How do you get PS3 emulator on Android? Sony PS3 Emulator is an Android emulator that simulates the Sony Play Station games to the Android phone. It’s easy; just install the app and follow the setup screen. Once the setup is finished, you can enjoy the games. Is God of War 3 playable on RPCS3? […]

Does Netflix have saw 6? Sorry, Saw VI is not available on American Netflix, but you can unlock it right now in the USA and start watching! With a few simple steps you can change your Netflix region to a country like Pakistan and start watching Pakistani Netflix, which includes Saw VI. Where Can U […]