Category: Social studies

How far is Fairbanks from Denver? 3101 miles How long is a flight from Colorado to Alaska? 5 hours, 31 minutes How long is a flight from China to Denver? Flying time from Denver, CO to Beijing, China The total flight duration from Denver, CO to Beijing, China is 13 hours, 13 minutes. How long […]

How long after eating beets is stool red? This usually lasts 48 hours, but it can vary in people who have a slow or faster rate of passing feces. It also depends on amount of fluids one drinks. Can beet juice turn your poop red? Can Beets Make Your Pee (And Poop) Red or Pink? […]

How do you get PS3 emulator on Android? Sony PS3 Emulator is an Android emulator that simulates the Sony Play Station games to the Android phone. It’s easy; just install the app and follow the setup screen. Once the setup is finished, you can enjoy the games. Is God of War 3 playable on RPCS3? […]

How much hot water should I drink a day? Ms Chopra recommends that you drink at least six to eight glasses of warm water daily. It is the amount you need in order to keep the body, hair, and skin hydrated. Is drinking warm water good for your body? Like taking a warm bath, drinking […]

What is the best type of kale to eat? Red kale is often considered the sweetest kale, which makes it perfect for eating raw. Use it in juices, smoothies, and salads-just massage and soften the leaves with your hands to break down the fiber and make it easier for digestion, says Torchia. What are the […]

What is the career path for an EMT? Emergency medical technician jobs have a built in career ladder at least at the early career stages. When you complete your first training, you’re classified as an EMT-Basic. You can be classified as an EMT-Intermediate after working as an EMT-Basic and completing additional training and licensing requirements. […]

What is the voltage on 3 phase? 208 volts Can you have 230V 3 phase? Even at three phase you can use the 230V. You’ll have 3 times the power available. That’s called a star configuration. In delta you’ll have 3 × 400V, that’s 5.2 × the power at the same current. Is 3 phase […]

Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]

What is characteristics of a tall tale? A tall tale is about a larger-than-life hero or heroine with superhuman abilities. Tall tales are often funny and outrageous, where everyday problems are solved in humorous ways. The stories feature exaggerated details to tell about the main character’s life and amazing feats of bravery and strength. What […]

What is the pH of potassium bitartrate? of 3.557 What is the chemical formula for potassium bitartrate? KC4H5O6 What is potassium hydrogen tartrate used for? Approved by the FDA as a direct food substance, potassium bitartrate is used as an additive, stabilizer, pH control agent, antimicrobial agent, processing aid, or thickener in various food products. […]