Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]
What is the best mosquito repeller?
What is the best mosquito repeller? Best personal mosquito repellents OFF! Repel Insect Repellent Mosquito Wipes 30% DEET. Natrapel Wipes. Skin So Soft Bug Guard Plus IR3535 Expedition SPF 30 Pump Spray. Kinfield Golden Hour Bug Repellent. Summit Mosquito Bits. Shoo For Good The Camellia Lightweight Wrap in Cloud. Do ultrasonic anti mosquito bracelets work? […]
What inspired Jules Verne to write about other worlds?
What inspired Jules Verne to write about other worlds? HE DREW INSPIRATION FROM HIS OWN SAILING ADVENTURES. During the 1860s, Verne’s career was taking off, and he was making good money. So in 1867, he bought a small yacht, which he named the Saint Michel, after his son, Michel. How long would it take to […]
What is characteristics of a tall tale?
What is characteristics of a tall tale? A tall tale is about a larger-than-life hero or heroine with superhuman abilities. Tall tales are often funny and outrageous, where everyday problems are solved in humorous ways. The stories feature exaggerated details to tell about the main character’s life and amazing feats of bravery and strength. What […]
What is the pH of potassium bitartrate?
What is the pH of potassium bitartrate? of 3.557 What is the chemical formula for potassium bitartrate? KC4H5O6 What is potassium hydrogen tartrate used for? Approved by the FDA as a direct food substance, potassium bitartrate is used as an additive, stabilizer, pH control agent, antimicrobial agent, processing aid, or thickener in various food products. […]
Is decaying of tooth physical or chemical change?
Is decaying of tooth physical or chemical change? Enamel. Tooth enamel is a highly mineralized acellular tissue, and caries act upon it through a chemical process brought on by the acidic environment produced by bacteria. Why is tooth decay a chemical reaction? The products of the reaction are calcium ions, phosphoric acid and water. All […]
How long does it take to drive from Detroit to Indianapolis?
How long does it take to drive from Detroit to Indianapolis? 4 hours, 35 minutes What city is halfway between Detroit and Ann Arbor? The city at the geographic halfway point from Ann Arbor, MI to Detroit, MI is Norwayne, Michigan. What is halfway between Indianapolis and South Bend? Logansport What is the halfway point […]
What is rice shaped pasta called?
What are the 10 largest freshwater lakes in the world?
What are the 10 largest freshwater lakes in the world? 10 Largest Lakes in the World Great Bear Lake (31,000 km2) Lake Baikal (31,500 km2) Lake Tanganyika (32,600 km2) Lake Michigan (58,000 km2) Lake Huron (59,600 km2) Lake Victoria (68,870 km2) Lake Superior (82,100 km2) Caspian Sea (371,000 km2) What are the 5 major lakes? […]