Category: Social studies

Is a Honda CR-V good for towing a caravan? The kids can be entertained in the back, there’s ample room for inflatable flamingos, and the Honda CR-V’s fuel-efficient and powerful 1.5-litre VTEC Turbo engine is capable of towing up to 2000kg – perfect for caravanning. What weight can I tow on my car Licence? A […]

What causes a football to spiral? Why football players throw spiral passes This is due to the football’s shape and angular momentum. When a player throws a football, the ball balances energy from the throw and the gravitational forces acting on it. What force is acting on the football players while they are standing? Normal […]

How far is Fairbanks from Denver? 3101 miles How long is a flight from Colorado to Alaska? 5 hours, 31 minutes How long is a flight from China to Denver? Flying time from Denver, CO to Beijing, China The total flight duration from Denver, CO to Beijing, China is 13 hours, 13 minutes. How long […]

How long after eating beets is stool red? This usually lasts 48 hours, but it can vary in people who have a slow or faster rate of passing feces. It also depends on amount of fluids one drinks. Can beet juice turn your poop red? Can Beets Make Your Pee (And Poop) Red or Pink? […]

What is the career path for an EMT? Emergency medical technician jobs have a built in career ladder at least at the early career stages. When you complete your first training, you’re classified as an EMT-Basic. You can be classified as an EMT-Intermediate after working as an EMT-Basic and completing additional training and licensing requirements. […]

What is the voltage on 3 phase? 208 volts Can you have 230V 3 phase? Even at three phase you can use the 230V. You’ll have 3 times the power available. That’s called a star configuration. In delta you’ll have 3 × 400V, that’s 5.2 × the power at the same current. Is 3 phase […]

Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]

How do you clean the headlights on a Hyundai Elantra? Clean the headlights of your car with a damp sponge sprinkled with a tablespoon of baking soda and then rinse. Clean the headlights of your Hyundai Elantra with a cloth and toothpaste . Spread toothpaste over the whole surface of your headlights and rub with […]

How do you get PS3 emulator on Android? Sony PS3 Emulator is an Android emulator that simulates the Sony Play Station games to the Android phone. It’s easy; just install the app and follow the setup screen. Once the setup is finished, you can enjoy the games. Is God of War 3 playable on RPCS3? […]

How much hot water should I drink a day? Ms Chopra recommends that you drink at least six to eight glasses of warm water daily. It is the amount you need in order to keep the body, hair, and skin hydrated. Is drinking warm water good for your body? Like taking a warm bath, drinking […]