Where is the DNA Fingerprinting and Diagnostics Center located?
Hyderabad
What part of the human genome is used for DNA fingerprinting?
introns
Which regions of DNA are used in DNA fingerprinting?
STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which is one of the main STR markers used for DNA fingerprinting. STRs occur throughout the genome.
What is DNA fingerprinting where is this technique used?
DNA fingerprinting is a laboratory technique used to establish a link between biological evidence and a suspect in a criminal investigation. A DNA sample taken from a crime scene is compared with a DNA sample from a suspect. DNA fingerprinting is also used to establish paternity.
What is DNA fingerprinting give two examples?
For example, from a hair left behind at the crime scene and from the blood of victims and suspects. They then narrow in on the stretches of repetitive DNA scattered throughout these samples.
What is STR in DNA fingerprinting?
Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence. For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times. STRs are found at different places or genetic loci in a person’s DNA.
Is VNTR hypervariable?
VNTR alleles are hypervariable regions of human DNA that differ from each other in: A. location of internal sites recognized by restriction enzymes.
What is difference between repetitive DNA and satellite DNA?
DNA is the genetic material present in the nucleus of the eukaryotic cells. A DNA sequence that is present multiple times in a haploid genome is called repetitive DNA….
| Repetitive DNA | Satellite DNA |
|---|---|
| It includes both highly repetitive andmiddle repetitive DNA. | It represents the highly repetitive DNA. |
Is repetitive DNA coding?
Occurrence: Gene sequences are typically unique and occur once in the genome, whereas repetitive DNA is recurring. Function: Gene sequences are translated and code for proteins, highly repetitive DNA sequences are typically non-coding.