What is the best type of kale to eat? Red kale is often considered the sweetest kale, which makes it perfect for eating raw. Use it in juices, smoothies, and salads-just massage and soften the leaves with your hands to break down the fiber and make it easier for digestion, says Torchia. What are the […]
Is a Honda CR-V good for towing a caravan?
Is a Honda CR-V good for towing a caravan? The kids can be entertained in the back, there’s ample room for inflatable flamingos, and the Honda CR-V’s fuel-efficient and powerful 1.5-litre VTEC Turbo engine is capable of towing up to 2000kg – perfect for caravanning. What weight can I tow on my car Licence? A […]
What causes a football to spiral?
What causes a football to spiral? Why football players throw spiral passes This is due to the football’s shape and angular momentum. When a player throws a football, the ball balances energy from the throw and the gravitational forces acting on it. What force is acting on the football players while they are standing? Normal […]
Is it OK to leave fly masks on horses at night?
How far is Fairbanks from Denver?
How long after eating beets is stool red?
Where is the DNA Fingerprinting and Diagnostics Center located?
Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]
How much does it cost to bale hay?
How much does it cost to bale hay? Swathing, $20-$22 per acre; Raking, $8-$10 per acre; Baling: small bales, 60-75 cents per bale; midsize (3×3), $10-$12 per bale; midsize (3×4), $14-$18 per bale; large square (4×4), $22-$25 per bale; round bales, $12-$15 per bale. How much does it cost to bale a round bale of […]
Are museums open in Idaho?
Are museums open in Idaho? We Are Open! The Idaho State Historical Society has updated its COVID-19 protocols under Stage 4 following Governor Little’s announcement on May 11, 2021. The Idaho State Museum requires face coverings be worn by visitors and staff indoors to help prevent the spread of COVID-19. Are museums open in Boise […]