What is the career path for an EMT? Emergency medical technician jobs have a built in career ladder at least at the early career stages. When you complete your first training, you’re classified as an EMT-Basic. You can be classified as an EMT-Intermediate after working as an EMT-Basic and completing additional training and licensing requirements. […]
What is the voltage on 3 phase?
Where is the DNA Fingerprinting and Diagnostics Center located?
Where is the DNA Fingerprinting and Diagnostics Center located? Hyderabad What part of the human genome is used for DNA fingerprinting? introns Which regions of DNA are used in DNA fingerprinting? STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which […]
Where is the blower motor located on a 2004 Grand Prix?
Where is the blower motor located on a 2004 Grand Prix? glove compartment Is it okay to drive with a bad blower motor? except blower motor resistors don’t “wear out”; they stop working altogether, suddenly, when the resistance wire inside burns through. Even then, it’s safe to drive the car provided that it has no […]
Do astronauts wear diapers when going to space?
Do astronauts wear diapers when going to space? Because they can’t simply drop their space suit and go, astronauts typically use a superabsorbent adult diaper. These diapers are able to hold up to a quart of liquid. Astronauts use adult diapers during take-offs and landings as well. What do astronauts do with their poop in […]
Do they still make DVD VCR combo players?
Do they still make DVD VCR combo players? The Samsung DVD-VR375 DVD Recorder – VCR Combination is one of the few DVD Recorder/VHS VCR combos that can still be purchased brand new if you shop around, but it’s fairly expensive to do so. Is Radvcr com legit? It’s bogus. Their website is hosted on GoDaddy […]
Can a person with disability join the military?
Can a person with disability join the military? In terms of military service, an injury or medical condition that is severe enough to warrant a VA disability rating will likely need a medical waiver to join the military once again. Members of the military suffering from PTSD must ask to get discharged from service due […]
Why do country fight with each other?
Why do country fight with each other? Question: Why do countries fight against each other? Answer: There are many potential reasons, including: competition over territory and resources, historical rivalries and grievances, and in self defense against an aggressor or a perceived potential aggressor. What are the causes of conflict in the world? a combination of […]
Where can I get my HP printer serviced?
Where can I get my HP printer serviced? Best hp printer repair in Los Angeles, CA WeFixPrinters. 13.7 mi. 88 reviews. Computer City Repairs. 6.9 mi. 391 reviews. Printer Repair Experts. 15.7 mi. Printer Repair Los Angeles. 3.5 mi. Printer Repair Pros. 20.5 mi. Alhambra Computer Services. 11.8 mi. Computer Palace. 7.4 mi. MEGACOM. 0.4 […]
How does layering keep you warm?
How does layering keep you warm? Layering works by creating air spaces between each layer of clothing to trap warm still air. This forms a microclimate that surrounds your body to keep you warm, whilst also transporting perspiration away from the skin so you remain dry and comfortable. How do layered outfits provide warmth? Three […]